ID: 956564742_956564744

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 956564742 956564744
Species Human (GRCh38) Human (GRCh38)
Location 3:70623828-70623850 3:70623858-70623880
Sequence CCAACTTCCTTTTGGGGAAATTA TCTATTACATGCTGCCTCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!