ID: 956594328_956594333

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 956594328 956594333
Species Human (GRCh38) Human (GRCh38)
Location 3:70949487-70949509 3:70949500-70949522
Sequence CCGGGGGATGGGGCATGGAGTGG CATGGAGTGGGGAGTAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 588} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!