ID: 956601974_956601976

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 956601974 956601976
Species Human (GRCh38) Human (GRCh38)
Location 3:71032256-71032278 3:71032278-71032300
Sequence CCTGGGCTGTGGCAATTGTGCTC CTGTCTGTGCAGTGGCACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145} {0: 1, 1: 0, 2: 4, 3: 37, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!