ID: 956609144_956609147

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 956609144 956609147
Species Human (GRCh38) Human (GRCh38)
Location 3:71104392-71104414 3:71104432-71104454
Sequence CCGCCCTTCTGCTGCTGTTGCTG GTTAAGAAGAATCACTTCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 97, 4: 588} {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!