ID: 956612327_956612329

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 956612327 956612329
Species Human (GRCh38) Human (GRCh38)
Location 3:71136669-71136691 3:71136701-71136723
Sequence CCATCAACAACTGTTTTTTGCTG TGACTGAACATTATGAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 360} {0: 1, 1: 0, 2: 1, 3: 7, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!