ID: 956615940_956615945

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 956615940 956615945
Species Human (GRCh38) Human (GRCh38)
Location 3:71172726-71172748 3:71172750-71172772
Sequence CCCTCTTCCTTCTGGATTCACTG TGGTATTTTTACTTGTTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 447} {0: 1, 1: 0, 2: 0, 3: 27, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!