ID: 956616105_956616108

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 956616105 956616108
Species Human (GRCh38) Human (GRCh38)
Location 3:71174360-71174382 3:71174375-71174397
Sequence CCCAGCTGCCTCTAAATAGCCAC ATAGCCACTGCACTCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125} {0: 455, 1: 1748, 2: 17173, 3: 194844, 4: 274037}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!