ID: 956616105_956616111

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 956616105 956616111
Species Human (GRCh38) Human (GRCh38)
Location 3:71174360-71174382 3:71174384-71174406
Sequence CCCAGCTGCCTCTAAATAGCCAC GCACTCCAGCCTGGGCAACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125} {0: 2407, 1: 4469, 2: 6286, 3: 8462, 4: 41765}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!