ID: 956629643_956629645

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 956629643 956629645
Species Human (GRCh38) Human (GRCh38)
Location 3:71303453-71303475 3:71303466-71303488
Sequence CCAATCAAATGGCCTGTACTCAT CTGTACTCATTTGCAAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 119} {0: 1, 1: 0, 2: 0, 3: 15, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!