ID: 956675829_956675837

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 956675829 956675837
Species Human (GRCh38) Human (GRCh38)
Location 3:71731052-71731074 3:71731079-71731101
Sequence CCAGCCACTCCCAGTCCTCACTC GTCAGCCAAGCATGGCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 509} {0: 1, 1: 0, 2: 4, 3: 21, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!