ID: 956678109_956678125

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 956678109 956678125
Species Human (GRCh38) Human (GRCh38)
Location 3:71753956-71753978 3:71753999-71754021
Sequence CCGGCGGAGCGGCGGAGCTCGGG GCGAGGCAGGGGACGGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136} {0: 1, 1: 0, 2: 0, 3: 29, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!