ID: 956753024_956753031

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 956753024 956753031
Species Human (GRCh38) Human (GRCh38)
Location 3:72359895-72359917 3:72359930-72359952
Sequence CCTCTGGAAAGGGTGACACAGAC GGATGTGTGACTTCACATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!