ID: 956760341_956760349

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 956760341 956760349
Species Human (GRCh38) Human (GRCh38)
Location 3:72437603-72437625 3:72437648-72437670
Sequence CCACTAGTTTCTTTTCCCAACCA CTAAATTGACAGAGGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 264} {0: 1, 1: 0, 2: 1, 3: 32, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!