ID: 956867735_956867738

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 956867735 956867738
Species Human (GRCh38) Human (GRCh38)
Location 3:73386046-73386068 3:73386064-73386086
Sequence CCATCTCAGCTACCTTCAGTGCA GTGCAGTAGGACACCTGTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 279} {0: 1, 1: 1, 2: 1, 3: 8, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!