ID: 956890877_956890882

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 956890877 956890882
Species Human (GRCh38) Human (GRCh38)
Location 3:73613177-73613199 3:73613191-73613213
Sequence CCACCAGGTAGACAATTTTTATT ATTTTTATTCTGAAGGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 307} {0: 1, 1: 1, 2: 2, 3: 41, 4: 509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!