ID: 956896065_956896067

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 956896065 956896067
Species Human (GRCh38) Human (GRCh38)
Location 3:73661184-73661206 3:73661200-73661222
Sequence CCTACCTGAGGCTGTTTGATAGT TGATAGTTAACTTTAAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 64, 3: 331, 4: 513} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!