ID: 956958617_956958624

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 956958617 956958624
Species Human (GRCh38) Human (GRCh38)
Location 3:74371847-74371869 3:74371889-74371911
Sequence CCTTAGCCTCGGAGAAGCCCCAT TCTTTTGCACGTGCTGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116} {0: 1, 1: 1, 2: 1, 3: 12, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!