ID: 956976998_956977000

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 956976998 956977000
Species Human (GRCh38) Human (GRCh38)
Location 3:74592296-74592318 3:74592313-74592335
Sequence CCTGTTCTAGAAGCTCAGTGGAG GTGGAGTAAAGGAGTTTAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!