ID: 956989850_956989859

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 956989850 956989859
Species Human (GRCh38) Human (GRCh38)
Location 3:74751054-74751076 3:74751079-74751101
Sequence CCTGGATCCCATGCCTGCCGAGG GAGCCAGGTGTGGAGCAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 78, 2: 150, 3: 235, 4: 388} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!