ID: 957022458_957022467

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 957022458 957022467
Species Human (GRCh38) Human (GRCh38)
Location 3:75140677-75140699 3:75140709-75140731
Sequence CCAACCTCCGAGACCATCCTTGG GACTGGGAGCTATACATGGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 15, 2: 62, 3: 54, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!