ID: 957026240_957026245

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 957026240 957026245
Species Human (GRCh38) Human (GRCh38)
Location 3:75185580-75185602 3:75185600-75185622
Sequence CCCTGCAACTGCCTTGCAAAGAA GAAACCTAAGCTAGACTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 310} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!