ID: 957044567_957044577

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 957044567 957044577
Species Human (GRCh38) Human (GRCh38)
Location 3:75363831-75363853 3:75363864-75363886
Sequence CCTTGGCACACCCGAATGCCGTG GCAGAAGGTCATCAACCTACTGG
Strand - +
Off-target summary {0: 3, 1: 23, 2: 15, 3: 21, 4: 49} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!