ID: 957085538_957085545

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 957085538 957085545
Species Human (GRCh38) Human (GRCh38)
Location 3:75673148-75673170 3:75673191-75673213
Sequence CCTTTAGTACTTTAAATATTTAT TAGGGCTTCCACTGTAAAGTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!