ID: 957112779_957112780

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 957112779 957112780
Species Human (GRCh38) Human (GRCh38)
Location 3:75987260-75987282 3:75987291-75987313
Sequence CCTGGCTAAGTTAATTACTAAGT CTTTTTGATGCTATAATCAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 179} {0: 1, 1: 3, 2: 53, 3: 324, 4: 975}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!