|
Left Crispr |
Right Crispr |
| Crispr ID |
957142899 |
957142904 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:76384569-76384591
|
3:76384608-76384630
|
| Sequence |
CCCAAGACTGGGTAATTTATAAA |
GACTCACAGTTCCACAGGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2548, 1: 10465, 2: 14335, 3: 13164, 4: 9470} |
{0: 14, 1: 381, 2: 3819, 3: 7199, 4: 8863} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|