ID: 957146770_957146775

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 957146770 957146775
Species Human (GRCh38) Human (GRCh38)
Location 3:76434752-76434774 3:76434769-76434791
Sequence CCGCTTCCTGCTCAGCCCTGTTT CTGTTTGCGCAGATTAATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 483} {0: 2, 1: 1, 2: 1, 3: 3, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!