ID: 957149146_957149148

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 957149146 957149148
Species Human (GRCh38) Human (GRCh38)
Location 3:76462978-76463000 3:76463009-76463031
Sequence CCAGTCTGAACAGTGTGTAGGTC TTGCCCATCACCGCATTACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70} {0: 1, 1: 0, 2: 1, 3: 1, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!