ID: 957155153_957155160

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 957155153 957155160
Species Human (GRCh38) Human (GRCh38)
Location 3:76536410-76536432 3:76536448-76536470
Sequence CCCTTCAGGGTTTAGGGCTGAAA CCACCAAGTGGGCCATGAACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 82, 3: 480, 4: 287} {0: 1, 1: 0, 2: 9, 3: 30, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!