|
Left Crispr |
Right Crispr |
| Crispr ID |
957189632 |
957189638 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:76990745-76990767
|
3:76990784-76990806
|
| Sequence |
CCTGATGAGATCTCAGGAGTTGG |
ATGCATATCAAGAGGCAAAACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 132, 2: 290, 3: 302, 4: 341} |
{0: 1, 1: 5, 2: 56, 3: 198, 4: 573} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|