ID: 957191692_957191694

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 957191692 957191694
Species Human (GRCh38) Human (GRCh38)
Location 3:77018377-77018399 3:77018420-77018442
Sequence CCAGTTAACAATATTCTAAATAT ACACTCAATATGTTTAAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 38, 4: 401} {0: 1, 1: 0, 2: 1, 3: 22, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!