ID: 957222547_957222554

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 957222547 957222554
Species Human (GRCh38) Human (GRCh38)
Location 3:77402515-77402537 3:77402567-77402589
Sequence CCTGAAACCGGTGATCAGAAACT GCTCAACTATGTGCACTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 180, 4: 352} {0: 1, 1: 0, 2: 16, 3: 84, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!