|
Left Crispr |
Right Crispr |
| Crispr ID |
957333204 |
957333209 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:78792839-78792861
|
3:78792854-78792876
|
| Sequence |
CCTGTAATCACAGCACTTTGGAA |
CTTTGGAAGGCGAAGGTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 101, 1: 12932, 2: 320493, 3: 262019, 4: 140984} |
{0: 4, 1: 1069, 2: 27256, 3: 105944, 4: 184043} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|