ID: 957368286_957368287

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 957368286 957368287
Species Human (GRCh38) Human (GRCh38)
Location 3:79255641-79255663 3:79255671-79255693
Sequence CCGTTCTGGAAGTATAGGTAAGC CACACACACATAATATTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 88} {0: 1, 1: 0, 2: 14, 3: 124, 4: 678}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!