ID: 957382449_957382451

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 957382449 957382451
Species Human (GRCh38) Human (GRCh38)
Location 3:79449792-79449814 3:79449830-79449852
Sequence CCAATAGATTTAAGCTCTTCATT TGTGATGGCCATAGTGTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 219} {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!