ID: 957474874_957474891

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 957474874 957474891
Species Human (GRCh38) Human (GRCh38)
Location 3:80709927-80709949 3:80709976-80709998
Sequence CCCAGTCAGGGGCTTGTAGATAA CCAGGGGAAGGGGTGGCTGTGGG
Strand - +
Off-target summary No data {0: 3, 1: 16, 2: 225, 3: 536, 4: 1249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!