ID: 957538098_957538105

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 957538098 957538105
Species Human (GRCh38) Human (GRCh38)
Location 3:81532020-81532042 3:81532061-81532083
Sequence CCCACAGTCACTGTGTTTTCCCT CTCTTCTTCCATGTGCCATGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 102, 4: 422} {0: 1, 1: 1, 2: 2, 3: 17, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!