ID: 957577680_957577685

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 957577680 957577685
Species Human (GRCh38) Human (GRCh38)
Location 3:82030742-82030764 3:82030787-82030809
Sequence CCCCATTACGATTTTTCAGTGAT CTGTAGAGACAGTAGCAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!