ID: 957624723_957624728

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 957624723 957624728
Species Human (GRCh38) Human (GRCh38)
Location 3:82642931-82642953 3:82642969-82642991
Sequence CCCTCAGACTCTGGAGAGAGAAA CTCTGTCCTCTCTACCAGATGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 9, 3: 48, 4: 406} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!