ID: 957694544_957694551

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 957694544 957694551
Species Human (GRCh38) Human (GRCh38)
Location 3:83618421-83618443 3:83618435-83618457
Sequence CCAGCCCCACACCACCCAGCGGG CCCAGCGGGTACTCCGAGTCCGG
Strand - +
Off-target summary No data {0: 2, 1: 5, 2: 6, 3: 20, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!