ID: 957738625_957738628

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 957738625 957738628
Species Human (GRCh38) Human (GRCh38)
Location 3:84233838-84233860 3:84233853-84233875
Sequence CCCTCTACTCACAGCTCCACTAG TCCACTAGGCAGTGACCCAGTGG
Strand - +
Off-target summary No data {0: 15, 1: 804, 2: 1196, 3: 1086, 4: 951}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!