|
Left Crispr |
Right Crispr |
| Crispr ID |
957810497 |
957810508 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:85215203-85215225
|
3:85215256-85215278
|
| Sequence |
CCTTCAAGGCAGTGGGCTCTCTT |
TGGGAACTAGGGTCTGGAATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 29, 2: 185, 3: 489, 4: 918} |
{0: 1, 1: 14, 2: 104, 3: 267, 4: 577} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|