ID: 957840497_957840502

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 957840497 957840502
Species Human (GRCh38) Human (GRCh38)
Location 3:85662569-85662591 3:85662601-85662623
Sequence CCATTCCTCCCAGATGGAGCAAC CTGCAAATGATACTTTTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 310} {0: 1, 1: 0, 2: 1, 3: 9, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!