ID: 957842750_957842754

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 957842750 957842754
Species Human (GRCh38) Human (GRCh38)
Location 3:85692896-85692918 3:85692931-85692953
Sequence CCACATACTTCACTGGTTGTTCT AAGAAAAATCAGAAGGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 185} {0: 1, 1: 1, 2: 8, 3: 142, 4: 1331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!