|
Left Crispr |
Right Crispr |
| Crispr ID |
957845162 |
957845167 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:85722204-85722226
|
3:85722243-85722265
|
| Sequence |
CCTCTCTGCAGCTGGTTATCCTG |
GCAGAGAGGAGACCCTGGAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 57, 2: 128, 3: 262, 4: 500} |
{0: 63, 1: 190, 2: 248, 3: 284, 4: 711} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|