ID: 957846894_957846902

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 957846894 957846902
Species Human (GRCh38) Human (GRCh38)
Location 3:85748638-85748660 3:85748662-85748684
Sequence CCTCAGTCTTTCCACAGCTGCCC CATCCTAATCCCATTTAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 367} {0: 1, 1: 0, 2: 1, 3: 6, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!