ID: 958057674_958057677

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 958057674 958057677
Species Human (GRCh38) Human (GRCh38)
Location 3:88434099-88434121 3:88434112-88434134
Sequence CCTAAAATGTAGACTTGGGGGCA CTTGGGGGCATGGAGGAGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 36, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!