ID: 958098892_958098903

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 958098892 958098903
Species Human (GRCh38) Human (GRCh38)
Location 3:88983511-88983533 3:88983529-88983551
Sequence CCCCCTCCCCACCACTGCTAGAA TAGAAATGTTTGGAAAATTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 51, 4: 493}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!