ID: 958112177_958112184

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 958112177 958112184
Species Human (GRCh38) Human (GRCh38)
Location 3:89162713-89162735 3:89162743-89162765
Sequence CCCAACCCTGCATGCTGGAACTG CTTTTAGAAAGATCTTGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 218} {0: 1, 1: 1, 2: 4, 3: 36, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!