ID: 958114345_958114354

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 958114345 958114354
Species Human (GRCh38) Human (GRCh38)
Location 3:89196026-89196048 3:89196075-89196097
Sequence CCTTCCTCCTTCTCCCAGTCATT TACAAGATACTGTCTACCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 847} {0: 1, 1: 0, 2: 1, 3: 6, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!