ID: 958167828_958167841

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 958167828 958167841
Species Human (GRCh38) Human (GRCh38)
Location 3:89900113-89900135 3:89900153-89900175
Sequence CCCAAAGTAGCCTAACTGGAGGC GAATGACACCTCACACGGCCGGG
Strand - +
Off-target summary No data {0: 15, 1: 964, 2: 1525, 3: 2149, 4: 1322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!